Journal: Scientific Reports

Article Title: Structural Analysis of Human Cofilin 2/Filamentous Actin Assemblies: Atomic-Resolution Insights from Magic Angle Spinning NMR Spectroscopy

doi: 10.1038/srep44506

Figure Lengend Snippet: ( a ) F-actin (blue) structure with G-actin protomers ( “n” and “n + 2” ) shown in purple. G-actin structure (purple) with subdomains labeled on the structure. ( b ) Actin treadmilling process for the polymerization and depolymerization of actin filaments. ( c ) TEM images of the NMR samples of U- 13 C, 15 N-CFL2 in complex with F-actin. ( d ) SDS-PAGE of CFL2/F-actin co-sedimentation. Samples containing either F-actin (42 kDa), CFL2 (18 kDa), or CFL2 complexed with F-actin were prepared under the conditions replicating the sample preparation for MAS NMR. Following ultracentrifugation, supernatants (s) and pellets (p) were resolved on SDS-gel.

Article Snippet: Tag-less full-length human CFL2 (cloned between NcoI and BamHI sites in pET15b vector (Novagen)) was expressed in Escherichia coli BL21-CodonPlus(DE3) (Agilent Technologies).

Techniques: Labeling, SDS Page, Sedimentation, Sample Prep, SDS-Gel

Journal: Scientific Reports

Article Title: Structural Analysis of Human Cofilin 2/Filamentous Actin Assemblies: Atomic-Resolution Insights from Magic Angle Spinning NMR Spectroscopy

doi: 10.1038/srep44506

Figure Lengend Snippet: ( a ) 2D NCACX (top), CORD (middle), and NCOCX (bottom) spectra. Selected chemical shift assignments and backbone walks are illustrated in the spectra. ( b ) Backbone walk for the stretch of residues D9-N16 obtained from 3D NCACX spectra (green contours) and 3D NCOCX spectra (black contours). ( c ) Human CFL2 sequence with secondary structure of CFL2 determined by TALOS+, where blue arrows represent β-strands, green boxes represent α-helices and yellow box represents 3 10 helix Colored in yellow and black are residues that are assigned and unassigned (not assigned a single atom), respectively. Spectra were processed with 30 degree sinebell and Lorentizan-to-Gaussian apodization. The first contour is set at 5x the noise level.

Article Snippet: Tag-less full-length human CFL2 (cloned between NcoI and BamHI sites in pET15b vector (Novagen)) was expressed in Escherichia coli BL21-CodonPlus(DE3) (Agilent Technologies).

Techniques: Sequencing

Journal: Scientific Reports

Article Title: Structural Analysis of Human Cofilin 2/Filamentous Actin Assemblies: Atomic-Resolution Insights from Magic Angle Spinning NMR Spectroscopy

doi: 10.1038/srep44506

Figure Lengend Snippet: ( a ) C α chemical shift perturbations between free CFL2 and CFL2/F-actin. Residues present in dREDOR experiments of CFL2/F-actin are shown with blue bars above the plot and labeled in blue. Chemical shifts of free CFL2 were determined by solution NMR experiments. Chemical shifts of CFL2/F-actin complexes were determined by MAS NMR experiments. ( b ) The residues constituting the corresponding chemical shift perturbations are mapped onto the CFL1 structure (PDB 1Q8G). Chemical shift perturbations between 2–4 ppm are shown in yellow and chemical shift perturbations above 4 ppm are shown in red.

Article Snippet: Tag-less full-length human CFL2 (cloned between NcoI and BamHI sites in pET15b vector (Novagen)) was expressed in Escherichia coli BL21-CodonPlus(DE3) (Agilent Technologies).

Techniques: Labeling

Journal: Scientific Reports

Article Title: Structural Analysis of Human Cofilin 2/Filamentous Actin Assemblies: Atomic-Resolution Insights from Magic Angle Spinning NMR Spectroscopy

doi: 10.1038/srep44506

Figure Lengend Snippet: ( a ) dREDOR-CORD spectra for human CFL2 in complex with F-actin. The residues constituting the corresponding intermolecular CFL2/F-actin interfaces were mapped onto the CFL1 structure (PDB 1Q8G) and are shown in purple in ( b ). Spectra were processed with 30 degree sinebell and Lorentizan-to-Gaussian apodization. The first contour is set at 5x the noise level.

Article Snippet: Tag-less full-length human CFL2 (cloned between NcoI and BamHI sites in pET15b vector (Novagen)) was expressed in Escherichia coli BL21-CodonPlus(DE3) (Agilent Technologies).

Techniques:

Journal: Scientific Reports

Article Title: Structural Analysis of Human Cofilin 2/Filamentous Actin Assemblies: Atomic-Resolution Insights from Magic Angle Spinning NMR Spectroscopy

doi: 10.1038/srep44506

Figure Lengend Snippet: Secondary structure elements are shown above (H denotes α-helices, B – β-strands). Residues previously determined uniquely by solution NMR experiments and cryo-EM studies to be involved in G-actin binding are shown on CFL1 sequence in green and blue, respectively. Residues reported to be involved in G-actin binding in both studies are shown in gray. Residues previously determined by cryo-EM experiments to be involved in the F-actin binding are shown in red. Interface residues determined by dREDOR-based methods are colored in purple on CFL2 sequence. On the primary sequence chemical shift perturbations greater than 2 ppm are indicated by blue asterisk and chemical shift perturbations greater than 4 ppm are indicated by a red asterisk.

Article Snippet: Tag-less full-length human CFL2 (cloned between NcoI and BamHI sites in pET15b vector (Novagen)) was expressed in Escherichia coli BL21-CodonPlus(DE3) (Agilent Technologies).

Techniques: Cryo-EM Sample Prep, Binding Assay, Sequencing

Journal: Scientific Reports

Article Title: Structural Analysis of Human Cofilin 2/Filamentous Actin Assemblies: Atomic-Resolution Insights from Magic Angle Spinning NMR Spectroscopy

doi: 10.1038/srep44506

Figure Lengend Snippet: ( a ) Structure of F-actin (cyan) decorated with CFL2 (gray) determined by cryo-EM (PDB 3J0S) . Two adjacent protomers of actin are shown as cartoons. ( b ) CFL2 interface residues S3, G4, V6, I12, K19, V20, R21, T25, I29, V36, L40, S41, T63, T69, T91, E93, S94, K95, K96, L99, V100, A105, A109, M115, I116, A123, I124, K127, T129, V137, T148, L153, V158, V159, L161 and G163 obtained from dREDOR-CORD MAS NMR experiments of CFL2/F-actin are shown in blue. Subdomains of actin protomers ( “n” and “n + 2” ) are colored in teal (SD1 n , SD1 n+2 ), green (SD2), and cyan (SD3, SD4). DNase binding loop (orange), N- and C-termini (yellow) are indicated on the actin structure. ( c ) Zoomed in region of ( b ) of CFL2 interfaces residues obtained from dREDOR-CORD MAS NMR experiments of CFL2/F-actin are shown in blue. ( d ) Chemical shift perturbations, 2–4 ppm (yellow) and above 4 ppm (red), between CFL2/F-actin and free CFL2 mapped onto cofilin structure. ( e ) Interface residues determined from cryo-EM studies mapped onto cofilin structure . Residues M1-V5, K19-R21, S94-D98, K112-S119 and G154-V158 are shown in orange.

Article Snippet: Tag-less full-length human CFL2 (cloned between NcoI and BamHI sites in pET15b vector (Novagen)) was expressed in Escherichia coli BL21-CodonPlus(DE3) (Agilent Technologies).

Techniques: Cryo-EM Sample Prep, Binding Assay

Journal: Molecular Systems Biology

Article Title: Quantitative contributions of TNF receptor superfamily members to CD8 + T‐cell responses

doi: 10.15252/msb.202110560

Figure Lengend Snippet:

Article Snippet: Cloning adapter for insertion of AviTag into BamHI cut site of pCR3‐FLAG‐TNC‐TNFSF constructs (reverse) , This study (supplied by Invitrogen – Thermo Fisher) , 3 ′ ‐GCCGGACTTGCTATAAAAACTTCGCGTCTTTTAACTTACCGTACTTTCTAG‐5 ′.

Techniques: Recombinant, Sequencing, Cloning, Construct, Software, Enzyme-linked Immunosorbent Assay